AZM Report: AZM5_6854


>AZM5_6854 
CTTAGCGCAAAAAAAAAAAAAAAAGAGCCAAGAGGCCGCCGGAGAAACACGAGCGAGTAT
ATAGCGTGCGCTTCGTCATCACCCACGACCACGAGCAAAACGAGGCCTTGCCTCTCCTCC
TCCCTCTCCCCTCTCCGCCTCTTCGGCCGCGCGGGGACGGACGGACGCCTACTATACGTG
CCATCGACGCCATCGACGCCATTCCGCCCGTAGTGCCACATCGGACGCTTGCCTCTTGGC
AGGTCGCCCGGATTCCTTTGCGGGCTGATCAACTACGCTCGGCCCAGCGGACGATGCTCG
GCCTGACGATAGACCCGCGTCTAATCTAAAAAAGAAGAAGACACAAGTATCACGTATTTT
GAGTTTTTTTCCAAACAGTTCTACAAGTAATCAAGTTTATACAAATACCACTAACGGTCT
ATGGCGTCGAACAAAGATAAATTACATTAATCTTCGAATATACGTACTCTCTCTCTCTCT
CCTCTAGCAACAGGATACGGATGGTCGGCCAAGGCAACCATGCTCCTTAGCATATTATTT
GCTCTCCTCCCATGACATTTGTTTAACCCGGTGGGTGTGGGTTAGCACATGGGCAAGAGG
TAGCGTCCATGATGGAGCTGGTGAGTGTCCAAACTACAAACAGATGCACCCCCGGGTTCC
CGTCGAAATGCTCCTCTAATCACCCACCCACCTGGTCCTTGTAGGGGCTGGGCTCTAGGG
TGGGAGAAAACGGAACACCCCGGGTGGCCCCACACGCGCACATCGGGAGATGCCCGCCTG
ACCTCTACGCCTCCGGCCGTCCCCCTCTCTCTCTCACTTTCTCTTCTCTCTCCCCGGCCA
GACACAAAAACTTTTACTTCCCCGAGGCGAGGCCCGCAGAAGCAGAGCAACGCACCAGCA
CGCACAGGCACATCTCCCCTACAACACGCATGCCCACGCTCTAGCTAGAGAAGCCGCCCT
GCCCTGCTGTGGTGGTGGTCTAGAGACAAACAAGCCTTTGGTCTCCGTGCGTGTATCATC
GTGTTGGTCTGCCTCCCTCCCTCCCTCGGCCCGCCCCCCTGCCTGCCTTCTCGCGCCCGC
TTCCACCCCTGTCCCTCCCGTGTCGGAGGGGACACGCGCGGCCGCGTGGGACGGGCGCAC
GGGCCTGCTCGCCTGCTCCGGCGCCGCCCATGCGCGGGGCCCGCTAGCTAGCCGACCTCT
CCCTCCCCCTCTCTCTCTCTCCATCGAGCGCTTGGTTGGCTAGCCGACGGTCCGGGACGC
GGAGGGAGATGATCAAGCAGCAGCAGCAGCAGGCGCCGCCGGCGCCTGCTCCGGCGGCAG
CGCCGCCGCCCAGCGCATGTGAAGGTATGCAGCGCTTGTTGATGGCAGCCTGGCGGGAAT
GGAATAGTGTCATCTTGGCTTTATATCGAGCTATTCTTCGTGGTGGGTGGGATCGGAAAG
CCCCTTTTGTTTTCCCGGCTGGACTTCTGGCCGCGGTTTTTTTCTTTCCCAAAGCGTTCT
TCTTCGGCTTCTGTGATTTCTGGAGATTTGCGGTGGGTTTTTTCTTCTGTTCACAAAGGA
GAGAGAAAAAAAGACGCCGCTGACCTCGCCGTCGCGGTCGTCGCCGGCCACTGGCGCGGA
GAAGTGCATGATTATTCTGCATTTATGCTCCTCCGTGTTCCCCCCCACGAGCTCCCGTCT
GGCGGTTCTTGAGTAGCAGTATGCTTCTTCCTTTCTTCGTGACGCGTTGATCCTTGAGAG
GGCATGCGCCAGCGCGAGCTGCAACGGCAGCCGCGGCGGTCTCCGTGCCTCCGGCGGAAT
TAGGGGGAGAGCAAAAGTAGCTCCCTTGTCTTTGTTATTGCTGATGATGCGACCGTGCGT
GTGTGTGCGCGCGCAGGGGAGAAGAAGGCGCCGCCGATCAACTCGGAGCTCTGGCACGCC
TGCGCGGGGCCTCTGGTGTCGCTGCCGCCGGCGGGCAGCCTCGTCGTCTACTTCCCCCAA
GGCCACAGCGAGCAGGTGAACCCACCCACCTCCCCTTTCTCGGAGCCTGCCCGCCTTACC
CGTGCTGCGATTCATCATTCACGGCGGCTCCTTCCTCCTCATTGGCTGCCTCTTTTGCCA
TATTTTTTTTGTAAATTTTTTTCCCCGTATGGTCTGACTTGTCCATGTGCCGCGACTTTT
TTAAAAATGCTTTCTAGTTGCCAATTCCTGCTTTGATGCTGTGCATAGGAATATCTTAAT
TCGAAATAACGGGGCCCTTTGGGGTCTTGACAGATGACAGGGCCAAGATTGGTTCCTGTC
GAATTTTAAATTGCTAAAAGTATCAGGGACGTGACTTGATTTGCTGTTCTCCATTTAGTT
TGTGTGGTGCTGCCAGTGCCAGTTGACAGGATCCTTTTCTGTTTAGGGTGATCATCACTA
TTTTGATGCACATATTTTTACAACAAAAAAAAAGTGTGCAAAATCTGTATCATATGCAGT
TGGGAGCAATGGGCCCACTCCCCCCCCCCCCCACACCCCCACTCCCCTTGTTTCATGGGT
TTCTGGTGTGCTGCACCATTCCCCTGCTTGCTGTTTGGTGGATGCAGGAGCCAAGTACGA
CTGAGTTTTAGCTTTTATAGCTGACGCTTTCAGTAACCTCTGTCACGAATCTCATGGATT
TGGTGCCAAAGAAGTTTGATTCGAGCAAGTTTAGACCTTGTTCGGTTGCATGTGTTGCAT
GGATGGAGGATTAAATCTCTTCCTATTTAATTTTTAAATAGGAAGGGATTTAATCTCTCC
GATCCGAATGCAACCGAACAAGGCCGGCCTCAGGGGTGGTGGTAGGATGATCACATGCTC
GGTTCTGGAAGAGATTCTCTGGCTGAATGCGAGTGCTGGGAGGTGCCCAACTTCGGTTTT
TCCTTTCCTTTTCGCTCGATGGAAGAAAACGGAAGCTTTTCAGTTATGATTGGCTGATGG
CTTCAGCGCACATGGTGGTTGTAGTAGCTCTGTGATGCAATGCATCTGTGTCATGTGCTG
TCGAATCCCAACGACTTTCGGTCACACCTTTCTCATTTGGCTTCTACAGTAGATGTTAGT
TTCGCACTGTGCTGGTGTTCAGGGATTTTCGGCCAGATTTACAACAGTAGTTACTGGTTC
TACACTGTGCAGCTTACAGGGGCTGTGTTTGAGGTTGAGTATGAGATTTAGAGTTGGCTC
TTACTGTAGGTTGCAGCTTCTATGCAAAAGGATGTTGACGGACATGTTCCAAGCTACCCA
AATCTTCCGTCGAAGTTGATTTGCCTTCTGCACAATGTCACTTTACATGTAATGTTCAGC
TGTGCCCCCATTTTAATTGTCTTCTGTTTGATCATTTATTAATTTATATACTAAAAGGAT
TTGTTCTGGGGGCTTTCGTAGGCGGATCCAGAAACAGATGAAGTGTATGCACAAATGACT
CTTTTGCCAGTTACTTCAGTACGTATCTCAGTGCTGCTCCTGGTTTGCCATAATGTTTTC
CTTCATTTCAGTATTTGTAACACAAGTTTTTGGACATCAAACTGACCGTTAACGGTGATC
AGTATGGAAAGGAGGCGCTGCAACTATCGGAACTAGCGCTGAAACAACCAAGGCCTCAAA
CAGAGTTCTTCTGTAAGACACTAACTGCAAGTGACACAAGCACTCATGGAGGCTTCTCCG
TGCCTCGTCGAGCAGCTGAGAAGATATTTCCACCCCTTGTATGTGAAGATTTGACTCCAC
ATGGTTTTTAGCATTTTATTCGTTATTGTAATTAAATGTACTCACATCCTGCTGTAGGAT
TTCTCCATGCAACCGCCCGCTCAAGAGATCCAAGCCAGAGATTTACATGATAATGTGTGG
ACATTCCGCCACATATATCGAGGTAAAAGCCGTCATGGAAATCTTTTTAGCTGAAAAATT
TAGGATCAGTGGCATAATGGATATTTACATGTAAATTTCTGTTTTATTGTCTTCAATACA
GTTGTGCATTGTTAGCTCATGTACACATTTTTTTTAAAAAGTTTTCACACGTTTTTTCAT
GGTTCTATCTTTTTCTTGCACATACAAACTTTTTAGGATGTTTGACCATCTCCATCTTTT
GGAATGAACAGGTCAGCCAAAAAGACATCTGCTTACCACTGGCTGGAGTCTTTTTGTGAG
CGGAAAGAGATTACTTGCTGGTGATTCTGTCATTTTTGTTAGGTACAGCTGTACATCGCA
GCTTCTGAGTCTATGCCATTGAAAATTTCTCTAAAAAGCTCATTAGAGATTAGCTCTTCT
TTTGTGGTCTTCATGGCTGATTCAACACTGACTATTCCTCTTTCTGTGTTTTTTGTTATA
TATGTTTTTAGGGATGAAAAACAGCAACTTCTCCTTGGAACCAGGCGTGCTAATAGACAG
CCAACTAACATATCATCATCTGTCCTTTCAAGTGACAGCATGCATATAGGAATTCTTGCT
GCTGCAGCCCATGCCGCTGCCAACAATAGCCCATTCACCATATTTTATAATCCTAGGTCT
GCACTGAGCAGTGAATTAATGTCTAATATTTACTATGCATGGGCTTTCTTCTACTGAGTG
CTAACAGCCATCAAAATCTCAAACTGAAAGCTTTTATTTTCAGGGCCAGTCCTACAGAGT
TTGTTGTCCCGTTTGCTAAGTATCAGAAGGCACTCTATGGTAATCAAATATCTTTAGGAA
TGCGCTTCCGCATGATGTTTGAAACTGAAGAATTAGGCACAAGAAGGTATACCTTATCTC
ACTTTACTTTTCCCTGCGTCAAGTGTGTTGACGCATTTCTAACAAACATAATGTGTTTTG
CTGATACTTCCAATTATAACTAGAAACCAAATTAAGCTGTTTTGACTAATTGCCATGTTT
CTGAAGTCTTTCGTGTATTTCCAGTTTTCTTTTTCATATTCCTACATGTTATTTTGCAGG
TACATGGGTACAATAACTGGTATAAGTGATCTAGATCCAGTAAGATGGAAAAACTCACAA
TGGCGCAACATACAGGTTGGTTTTCTAGTTAATTTCGTTGCATCCTGTGCGCTACCCTTT
TCCCCTTTTCCGTTGCTGATACAGATTCTTTTGTGACCTAAAGAGATTGTATTTTTTTCA
ATAGGTCGGCTGGGATGAGTCTGCAGCAGGCGAAAGGCGGAACAGGRTTTCAATCTGGGA
AATCGAACCGGTTGCTGCTCCTTTTTTCATATGCCCTCCACCATTTTTTGGTTCAAAACG
TCCCAGACAATTAGGTATGCTCTGGTGTTTACATTAGCATTAGTTTCATATGTCAGGACT
TCTTTTTCTAGATAGTTTGGTAGGTCAGGGATGTTATTCCTCAAGCTATACTACTGAAGA
TGCTTGGTAGTCTTCTTTCGATTATAGCTTTCCTGTTAATGAATTCTATATATATTTTGT
GATTTTAAGATTTAAGAGTAGTTTTGAGCCCTCAGAAATGGAGAACCTCTTAAAGATGGC
ATGGGTGTACAATAAATTATCTCTGCTATGTACTTGCAGATGACGAGTCCTCAGAAATGG
AGAATCTTTTAAAGAGGGCAATGCCATGGCTTGGTGAGGAGATATGCATAAAGGATCCAC
AGACGCAGAACACCATAATGCCTGGTCTGAGCTTGGTTCAGTGGATGAACATGAATATGC
AGCAGAACTCATTTGCAAACTCGGCTATGCAGTCCGAGTACCTACGATCGCTAAGCAACC
CCAACATGCAAAATCTTGGCGTGGCTGATCTCTCAAGGCAGTTAAACCTTCAGAACCAGA
TTCTGCAACAGAACAGCATTCAGTTTAGTTCTCCTAAACTGCCTCAACAAATGCAGCTGG
CCAATGAGTTGTCAAAGGCATCTCTTCCACTGAATCAGATTGGTGTGGGCACCAAACCTC
AAGAACAGACTCAAGACCCAAACAATCTGCAGAGGCAACAACAGTCCATGAACCAACTAC
TTCCATTGAGCCAATCTCAAACCAATCTTGTCCAGGCTCAGGTCCTTATCCAGAATCAAA
TGCAGCAGCAAAAGCAACCAACATCCATGGCTCAAAATCAGCAGCCAGCTGCCAGCCAGT
CACTGATCCTGCCCCAGCAGCAGCAACAACAGCAACAACATCAACAACAAAAGTTGGTAC
ATCAACAGCAGCAGATTTTACTGCAGCAGCAACAATTGCAGCAACAGCAACAATTGCAGC
AACAGCAACAAAATCAGCAACAGCTAAATAAGATGGCTGCACAAATGCCAAATCTGGCAT
CACATCAGCCGCAACTGTCTGATCAGCAGCTTCAACTGCAACTGTTACAAAAACTGCAAC
AGCAGCAGCAGTCGTTGCTATCACAACCAGCTGTTACTCTTGCACAATTACCCCTAATCC
AAGAGCAGCAAAAGTTGATTATTGATATGCAGCAGCAGTTGTCAAATTCTCAACCACTTT
CCCAGCAACAAACAATGCCCCAACAAAGTATTCAAGTTCCATCACGGGCAACACCACCAC
CAACAACAACCGTGCAACAAGAGTCACAGCAAAAGCTTCCACAAAAGCATGTTGGGTTCA
CTGACACATCACATACCACCATTCCTCCGACTACATCAGTCAACACCATTTCAGTTGTAG
GAAGTCCTCTGATGGCA
1==================================AZM5_6854================================6617
   1    >          <   4      <    9                      <   15              18>
      <  2a          <5       <  10   
        2b  >                       11    >
            3a    >
         ....<  3b  
                           6a>
                           .......< 6b 
                               7a   >
                            .......<   7b    
                              8a  >
                             .< 8b.
                                      12a    >
                                   .........<   12b   
                                       13a    >
                                    .....<   13b    
                                                     14a   >
                                                  .....<   14b   
                                                                 16a    >
                                                              ......<    16b    
                                                                  <   17a   
                                                                     17b   >

                                                                      
 #  Src  Seq Id      GB#           Clone           left  right
                                                                      
 1  TIGR PUEEJ13TD   CC353722  PUEEJ13             1   780 High-CoT library
 2a TIGR OGAKI05TM   BZ537164  OGAKI05           530  1049 Methyl-filtered library
 2b TIGR OGAKI05TC   BZ537160  OGAKI05           530  1049 Methyl-filtered library
 3a TIGR OGCBS58TM   BZ660306  OGCBS58           738  1539 Methyl-filtered library
 3b TIGR OGCBS58TC   BZ660300  OGCBS58          1058  1687 Methyl-filtered library
 4  TIGR OGAIC12TC   BZ532627  OGAIC12          1544  2281 Methyl-filtered library
 5  TIGR OGEBF32TC   BZ708750  OGEBF32          1707  1814 Methyl-filtered library
 6a TIGR OGEAQ72TM   BZ716713  OGEAQ72          2206  2509 Methyl-filtered library
 6b TIGR OGEAQ72TC   BZ716703  OGEAQ72          2847  3199 Methyl-filtered library
 7a TIGR OGWMN73TV   CG336596  OGWMN73          2280  3079 Methyl-filtered library
 7b TIGR OGWMN73TH   CG336585  OGWMN73          2867  3708 Methyl-filtered library
 8a TIGR OGAOQ65TC   BZ646657  OGAOQ65          2373  2876 Methyl-filtered library
 8b TIGR OGAOQ65TM   BZ646666  OGAOQ65          2506  2837 Methyl-filtered library
 9  TIGR OG5DX69TC   CG443862  OG5DX69          2499  3281 Methyl-filtered library
10  TIGR OG5CO28TC   CG326500  OG5CO28          2509  3110 Methyl-filtered library
11  TIGR PUDGY58TD   CC014655  PUDGY58          2709  3565 High-CoT library
12a TIGR PUHNH64TD   CC357249  PUHNH64          2860  3806 High-CoT library
12b TIGR PUHNH64TB   CC357247  PUHNH64          3604  4463 High-CoT library
13a TIGR OGUKQ11TV   CC726069  OGUKQ11          2954  3878 
13b TIGR OGUKQ11TH   CC726058  OGUKQ11          3421  4269 
14a TIGR PUFWA24TD   CG183880  PUFWA24          4138  4971 High-CoT library
14b TIGR PUFWA24TB   CG183878  PUFWA24          4562  5357 High-CoT library
15  TIGR PUDHB05TD   CC005092  PUDHB05          4797  5633 High-CoT library
16a TIGR PUJCH66TB   CG040910  PUJCH66          5142  6006 High-CoT library
16b TIGR PUJCH66TD   CG040912  PUJCH66          5647  6617 High-CoT library
17a TIGR PUGHP18TB   BZ986238  PUGHP18          5467  6268 High-CoT library
17b TIGR PUGHP18TD   BZ986240  PUGHP18          5469  6313 High-CoT library
18  TIGR PUHIF26TB   CC421961  PUHIF26          6489  6616 High-CoT library

Sequence source codes:

TIGR The Institute for Genomic Research

Best hits for AZM5_6854 :
Hit% ID% SimSeq LeftSeq RightHit LeftHit RightHit Name
UP|Q8S979 91.98 95.73188564825689Auxin response factor 7a (Fragment)
UP|Q5Z826 92.41 96.031885646443721Putative auxin response factor 7a
UP|Q6Z2W3 84.11 89.641849647622710Putative auxin response factor 7a
UP|Q6L8U2 87.06 92.721897563327428Auxin response factor 2
UP|Q6YZW0 83.86 90.741900563323428Auxin response factor 7b
UP|Q9NP08 89.47 94.7416098884790H6 homeodomain protein


Click here for a printable version of the assembly alignment: